Science Fair Project Encyclopedia
Hairpin loop
A hairpin loop in RNA is a sequence of nucleotides where a long segment of RNA can base-pair with each other, but a segment within that sequence can not base pair, causing a hairpin loop.
An example of a 5' → 3' sequence of RNA which would lead to a hairpin loop structure is:
GCCGCGGGCCGAAAAAACCCCCCCGGCCCGCGGC
The above sequence is an example of dyad symmetry, where the bases downstream are complementary to the bases upstream and so they form base pairs.
Hairpin loops are important in prokaryotic transcription termination. The hairpin loop forms during transcription and the structure causes the RNA polymerase to become dissociated from the DNA template strand. This process is known as rho-independent or intrinsic termination.
10-26-2009 08:16:03
The contents of this article is licensed from www.wikipedia.org under the GNU Free Documentation License. Click here to see the transparent copy and copyright details
The contents of this article is licensed from www.wikipedia.org under the GNU Free Documentation License. Click here to see the transparent copy and copyright details