Science Fair Projects Ideas - Shotgun sequencing

All Science Fair Projects

      

Science Fair Project Encyclopedia for Schools!

  Search    Browse    Forum  Coach    Links    Editor    Help    Tell-a-Friend    Encyclopedia    Dictionary     

Science Fair Project Encyclopedia

For information on any area of science that interests you,
enter a keyword (eg. scientific method, molecule, cloud, carbohydrate etc.).
Or else, you can start by choosing any of the categories below.

Shotgun sequencing

Shotgun sequencing is a method used in genetics for sequencing long DNA strands. Since the chain termination method can only be used for fairly short strands, it is necessary to divide longer sequences up and then "assemble" the results to give the overall sequence. In chromosome walking, this division is done by progressing through the entire strand, piece by piece; shotgun sequencing uses a faster, but more complex, process to assemble random pieces of the sequence.

In this technique, small segments of the target DNA strand are cloned randomly, and then these clones are sequenced using the chain termination method. By doing this for several copies of the same long DNA strand, overlapping fragments are created. Finally, computer programs align these overlapping sequences and determine the original (long) sequence.

An extremely simplified example with only two sequences is as follows:

Original strand         : XXXAGCATGCTGCAGTCATGCTTAGGCTAXXXX
First shotgun sequence  : XXXAGCATGCTGCAG
                                         TCATGCTTAGGCTAXXXX
Second shotgun sequence :                      TTAGGCTAXXXX
                          XXXAGCATGCTGCAGTCATGC
Reconstructed strand    : XXXAGCATGCTGCAGTCATGCTTAGGCTAXXXX

In real-world applications, there are thousands or millions of sequences to deal with, with the addition of transcription and sequencing errors. The computational power required to re-align the sequence in real projects is enormous. For the shotgun sequencing of the human genome in the Human Genome Project run by Celera Genomics in 2000, several supercomputers were running some months nonstop to align all human DNA correctly.

See also

10-26-2009 08:16:03
The contents of this article is licensed from www.wikipedia.org under the GNU Free Documentation License. Click here to see the transparent copy and copyright details
Science kits, science lessons, science toys, maths toys, hobby kits, science games and books - these are some of many products that can help give your kid an edge in their science fair projects, and develop a tremendous interest in the study of science. When shopping for a science kit or other supplies, make sure that you carefully review the features and quality of the products. Compare prices by going to several online stores. Read product reviews online or refer to magazines.

Start by looking for your science kit review or science toy review. Compare prices but remember, Price $ is not everything. Quality does matter.
Science Fair Coach
What do science fair judges look out for?
ScienceHound
Science Fair Projects for students of all ages
All Science Fair Projects.com Site
All Science Fair Projects Homepage
Search | Browse | Links | From-our-Editor | Books | Help | Contact | Privacy | Disclaimer | Copyright Notice